Chasis chasis Hexa DJI

Tema en 'DJI' iniciado por funfly, 20 Ene 2012.

  1. funfly Gurú FPV

    10 Ene 2009
    Me Gusta recibidos:
    personalmente, me parece precioso, estara disponible en febrero


    Model Flame Wheel 550 (F550) Frame Weight 478g Diagonal Wheelbase 550mm Takeoff Weight 1200g ~ 2400g Recommended Propeller 10 × 4.5in ; 8 × 4.5in Recommended Battery 3S~4S LiPo Recommended Motor 22 × 12mm (Stator size) Recommended ESC 30A OPTO
    [​IMG] [​IMG] [​IMG]
    [​IMG] [​IMG] [​IMG]
    #1 funfly, 20 Ene 2012
    Última edición por un moderador: 28 Sep 2013
  2. elpuerto Miembro Activo

    3 Ago 2008
    Me Gusta recibidos:

    Esto es lo que yo estaba esperando.

    Apuntame unoooooo.

    Sabes algo del pvp?

  3. aero-plano Miembro

    30 Jun 2011
    Me Gusta recibidos:
    pues yo hasta que no vea un vídeo en el que lo tiren de un 25º piso y aguante...como que no me o creo:laugh:

    no, en serio, ya sabes si también saldrá en kit?
  4. sergafa Miembro

    7 Ene 2009
    Me Gusta recibidos:
    buena pinta

    Tiene muy buena pinta. Si funciona como el de 4 será un exitazo ya que podrá cargar más peso. Entiendo que saldrá el kit con los msmos motores que el frame de 4 ?
    Y seria genial que lo hicieran plegable. :biggrin2::biggrin2:
    Saludos a todos.
    Hola Pedro, vas todo loco por conseguir uno he?
  5. benjamin2h Miembro

    27 Ene 2011
    Me Gusta recibidos:
    primer video:

  6. josete Miembro

    11 Jul 2007
    Me Gusta recibidos:
    Nuevo chasis DJI NAZA hexacopter

    Muy interesante este chasis,me reservo uno si se puede,un saludo y buenas noches.
  7. funfly Gurú FPV

    10 Ene 2009
    Me Gusta recibidos:
    la verdad que tiene una pinta estupenda, no hay precio por el momento, estan de vacaciones hasta el dia 1 de febrero

  8. sergafa Miembro

    7 Ene 2009
    Me Gusta recibidos:
    una pregunta

    Buenas noches, funfly queria hacer una pregunta.
    Cuanto dura aprox. un vuelo con el kit completo del Naza? Con sus motores originales, variadores y chais de 450.
    Creo que dijiste que con una bateriade 2200mAh unos 12 min?. O ese tiempo era cargando una Gopro.
    Si es así, es muy aceptable verdad?
    Cuanto duraria con una de 4s?
    Saludos y gracias.
  9. funfly Gurú FPV

    10 Ene 2009
    Me Gusta recibidos:
    el mio con 2200 me dura los 10 mn, con 3S, con 4S, el fabricante recomienda usar palas mas grandes, asi que el tiempo creo que sera el mismo
  10. sergafa Miembro

    7 Ene 2009
    Me Gusta recibidos:
    Muchas gracias y perdona por hacer la pregunta en el hilo del chasis hexa. Ha sido un despiste mio. :tongue2::tongue2:
    Un saludo a todos y estamos a la espera que salga este nuevo chasis.
  11. mawind Nuevo Miembro

    28 Dic 2011
    Me Gusta recibidos:
    Tiene un aspecto increible. A simple vista le encuentro una pega, que le falta una bandeja más para colocar todos los trastos del FPV y un anclaje en la placa inferior para el tren de aterrizaje y soporte de la gopro.
  12. juanma Nuevo Miembro

    6 May 2011
    Me Gusta recibidos:
    Tiene buena pinta, parece indestructible
  13. paramotero Nuevo Miembro

    19 Oct 2011
    Me Gusta recibidos:
    Espero que tenga mejor calidad que el F450.
    Mi F450 se cayó de sólo 4 ms, y se rompió el brazo justo por donde se coloca el motor.
    Ahora quisiera encontrarme yo con el chino de Dji que grabó el video tirándolo al suelo y desde una ventana, y aquello no se rompía. Porque se lo iba a tirar a la cabeza.
    Aunque para empezar un novato como soy yo, creo que está bien.
  14. benjamin2h Miembro

    27 Ene 2011
    Me Gusta recibidos:
  15. josete Miembro

    11 Jul 2007
    Me Gusta recibidos:
    Nuevo chasis DJI NAZA hexacopter

    Hola ,que pasada de chasis,pero me sorprende mas el soporte de camara:icon_eek::icon_eek::icon_eek:,que pasada:eek:
  16. sergafa Miembro

    7 Ene 2009
    Me Gusta recibidos:
    El chasis tambien esuna maravilla, creo que van a ir palas de 14" o de 15" . y además los brazos son extraibles. con los contactos en los extremos para los variadores.
    Fun fly, cuando te lleguen noticias de los precios, haznoslo saber.. que vamos todo locos. :ansioso::ansioso::ansioso::ansioso:
    Yo por mi parte, estoy todavia :baba::baba::baba::baba:
    de ver el movimiento de la bancada que no se que precio y que peso tendrá.
    Saludos a todos.
  17. funfly Gurú FPV

    10 Ene 2009
    Me Gusta recibidos:
    ya os contare si merece la pena o no, me mandan uno para probar esta semana:rolleyes2:
  18. sergafa Miembro

    7 Ene 2009
    Me Gusta recibidos:
    Maravilloso, ya comentarás cuando puedas tu opinión y valoración del kit, ya que la emisora con pantalla lcd incorporada y con un tx de 10 km en control y 5 km en video tiene que ser la lehe...
    Valdrá un riñon y las piedras del otro. :locos::locos::locos:
    Bueno ya veremos que nos cuentas.
  19. Extebank Miembro

    12 Ago 2011
    Me Gusta recibidos:


  20. Extebank Miembro

    12 Ago 2011
    Me Gusta recibidos:
  21. sergio00 Administrator

    30 Ago 2006
    Me Gusta recibidos:
    Muy lindo, tiene la pinta de ser esos plasticos resistentes a alto impacto. Es asi Fun?

    Entre materiales compuestos vs aluminio/carbono a la larga los compuestos creo ganarán porque el metal acumula fatiga, el carbono resiste pero depende de la dirección de la fuerza pero los compuestos,, los compuestos le das por todos lados y aguantan más. Están sustituyendo muchos materiales.

    Muy lindo
  22. Extebank Miembro

    12 Ago 2011
    Me Gusta recibidos:

    Las palas Funfly, las palas esas tienen que ser la ho:censurado:a.

  23. Atlantis Miembro Activo

    2 Ago 2011
    Me Gusta recibidos:

    Si , parece que son las palas de moda, la cuestión es que cada pala cobran 45 euritos por ellas . ::sad::sad::sad::sad::sad::sad::sad:
  24. paramotero Nuevo Miembro

    19 Oct 2011
    Me Gusta recibidos:
    Vaya pasada de Chasis, guaaaaaaaaaauuuuuuuu QUE ESTABILIZACION tiene esa bancada para el soporte de cámara.
    Lo mejor que he visto hasta ahora.
  25. diafragma1939 Miembro

    5 Ene 2012
    Me Gusta recibidos:
    …tanto equipo para luego meter una Sony Nex (¿una 5n? no pue sé…) en vez de la Canon MarkII 5D en el gimbal… :eek:

    Ni p:censurado: idea vamos… ( o al menos eso opinan los grandes "connaisseurs del medio… :tongue2:)

  26. mawind Nuevo Miembro

    28 Dic 2011
    Me Gusta recibidos:
    Me parece que hay algun error... Yo creo que el kit hexa de NAZA que se va a vender ahora no tiene nada que ver con el que aparece en el video de you tube...el de los patines y el gimbal.... presentado en la Feria de Nuremberg . Ese tal vez sea una evolucion futura o la versión Pro...pero no se parece en nada, ni el frame ni nada con el que NAZA tiene anunciado en su web y que va a ser el que pronto saldrá a la venta. Es así Funfly? Sácanos de dudas tu que eres en representante en España.
  27. aero-plano Miembro

    30 Jun 2011
    Me Gusta recibidos:
    Querido amigo, ni el chino ni tu han vendido en su vida un trabajo para TV. El chino vende cosas que vuelan y tu.....¿?:laugh::laugh::laugh::laugh::laugh::laugh:
  28. josete Miembro

    11 Jul 2007
    Me Gusta recibidos:
    Nuevo chasis DJI NAZA hexacopter

    Bueno creo que muestran el chasis mas el gimbal,no se preocupan de la camara ya que no es necesario para la demostracion,estos chinos son la tira de listos,y simpaticos oye,la guerra de las TIERRAS RARAS, me Voy a la escuela de idiomas,por supuesto a estudiar chino,el futuro :laugh::laugh::laugh:
  29. benjamin2h Miembro

    27 Ene 2011
    Me Gusta recibidos:
    El frame del video es el s800 y el que viene a españa de momento sera el f550 "similar el f450 naza" pero en hexa, creo que nada que ver con el S800 mas orientado el uso profesional.
  30. diafragma1939 Miembro

    5 Ene 2012
    Me Gusta recibidos:
    "...puede que la respuesta no este en el interior de la empanada pero en tu empanada interior... "

    American Dad


    A esa pregunta ya he respondido en algún momento en otro hilo y creo que fue en respuesta a una pregunta similar o asunción que hiciste equivocadamente... Y ya van unas cuantas...
  31. jbc Miembro

    15 Ene 2012
    Me Gusta recibidos:
    Una pintaza, tanto el soporte de cámara como el chasis.

    En esas áreas el I+D+I aun tienen mucho recorrido.

  32. funfly Gurú FPV

    10 Ene 2009
    Me Gusta recibidos:
    el nuevo chasis S800 no esta en venta, lo estara en un par de meses, asi, que a esperar y ver los precios
  33. leandrorc Maestro FPV

    3 Jun 2010
    Me Gusta recibidos:

    muy chulo el soporte .
  34. Nyru Nuevo Miembro

    15 Ene 2011
    Me Gusta recibidos:
  35. poli28 Miembro

    31 Mar 2010
    Me Gusta recibidos:
    Funfly, ya sabemos cuando estara el 550 a la venta??? quiero uno y dos motores jejejeje.
  36. funfly Gurú FPV

    10 Ene 2009
    Me Gusta recibidos:
    lo estoy esperando para principios de la semana q viene
  37. JIR Nuevo Miembro

    11 Nov 2011
    Me Gusta recibidos:

    Tiene buena pinta
  38. megaPRO Miembro

    13 Dic 2011
    Me Gusta recibidos:
    Hola, en stockrc veo k ya tienes el Frame a partir de mañana, tendrás kit con dji WKM o Naza???

    Lo digo por esperarme unas semanas y no pillarlo por sepa ra do, que hay crisis. :biggrin:

  39. funfly Gurú FPV

    10 Ene 2009
    Me Gusta recibidos:
    esperad al lunes

  40. megaPRO Miembro

    13 Dic 2011
    Me Gusta recibidos:
    A esperar pues, :ansioso:, como la noche de RRMM, el S800 será el PRO?, el gimbal y el tren te caerán próximamente???? Porque me gustan k te ca:censurado:s, es lo mas parecido a mi steadyCam, pero en el aire.:plane:

    Esperando pues la comercialización de ese fabuloso gimbal&tren, ves con buena cara ponerle el AV200 Pro mount, con k tren?
    El kit F550 con la DJI WKM me lo pidoooo:party:, creo k será la mejor inversión para mi canon DSLR. Por si tienes que numerar el orden de pedido.
    #40 megaPRO, 17 Feb 2012
    Última edición: 20 Feb 2012
  41. moevious Nuevo Miembro

    16 Ene 2012
    Me Gusta recibidos:
    Se sabe algo del nuevo hexa DJI

    Funfly quería saber si ya has probado el nuevo hexa de DJI, cual ha sido tu impresión con respecto al 450, más estabilidad, mejor manejo, más playload? toy ansioso por conocer esos resultados.
    un saludo.
  42. funfly Gurú FPV

    10 Ene 2009
    Me Gusta recibidos:
    lo acabo de recibir, lo voy a montar esta tarde, luego os cuento, ya esta en stock:ansioso:
  43. megaPRO Miembro

    13 Dic 2011
    Me Gusta recibidos:
    Esperamos ansiosos tus experiencias, llevo todo el finde, supongo que como la mayoría, haciendo números para pillarlo, en mi caso en un Pack, Frame+electrónica, perdón por mi ig norancia, pero que diferencia hay entre los packs y comprarlos por separado, gracias.
    Me refiero si al comprarlos en kit conjunto vienen preconfigurados como hexas....etc :ansioso:
    #43 megaPRO, 21 Feb 2012
    Última edición: 21 Feb 2012
  44. xerbar Miembro

    10 Nov 2011
    Me Gusta recibidos:
    Eso, eso cuéntanos que tal ese chasis que tiene muy buena pinta y me interesa para sustituir el mio actual.

    Un Saludo.
  45. mawind Nuevo Miembro

    28 Dic 2011
    Me Gusta recibidos:
    Desde luego la pinta es extraordinaria. Yo creo que StockRC pensara en hacer un pack del frame y el DJI sé, digo yo... También me guistaría saber si se pueden comprar aparte placas superiores sueltas de este kit, para añadírselas por encima o por debajo del frame para el equipo FPV y/o patines y gimbal, ya que es un tema a tener en cuenta.
  46. funfly Gurú FPV

    10 Ene 2009
    Me Gusta recibidos:
    MUy buena pinta:ansioso::ansioso:, es precioso

    las patas son las mismas que el 450
  47. megaPRO Miembro

    13 Dic 2011
    Me Gusta recibidos:
    Yo ya lo tengo en la cesta,[2]

    Busco el gimbal y el tren para una canon dslr.
  48. megaPRO Miembro

    13 Dic 2011
    Me Gusta recibidos:
    Lo has probado??? Configuración???:baba:
  49. poli28 Miembro

    31 Mar 2010
    Me Gusta recibidos:
    funfly, no encuentro el chasis suelto... lo vas a tener suelto para los que tenemos el 450???? dime cosas.
  50. megaPRO Miembro

    13 Dic 2011
    Me Gusta recibidos:

Compartir esta página